Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pZac2.1 GfaABC1D ChR2(H134R) mCherry SV40
(Plasmid #112496)


Item Catalog # Description Quantity Price (USD)
Plasmid 112496 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5300
  • Total vector size (bp) 7033
  • Modifications to backbone
    GfaABC1D promoter
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Channel Rhodopsin
  • Species
  • Insert Size (bp)
  • Mutation
  • Promoter GfaABC1D
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TTGAGCAGGGGGCTTGCATT
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZac2.1 GfaABC1D ChR2(H134R) mCherry SV40 was a gift from Baljit Khakh (Addgene plasmid # 112496 ; ; RRID:Addgene_112496)
  • For your References section:

    Transient, Consequential Increases in Extracellular Potassium Ions Accompany Channelrhodopsin2 Excitation. Octeau JC, Gangwani MR, Allam SL, Tran D, Huang S, Hoang-Trong TM, Golshani P, Rumbell TH, Kozloski JR, Khakh BS. Cell Rep. 2019 May 21;27(8):2249-2261.e7. doi: 10.1016/j.celrep.2019.04.078. 10.1016/j.celrep.2019.04.078 PubMed 31116972