Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pCW-Cas9
(Plasmid #50661)

Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pCW57.1
  • Backbone size w/o insert (bp) 7600
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Sequence Information

Gene/Insert

  • Gene/Insert name
    humanized S. pyogenes Cas9
  • Insert Size (bp)
    4300
  • Promoter Tet ON
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer CACATTCTTCACGTCCGTTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    human codon optimized 3XFLAG-SpCas9 was cloned from Plasmid 42230: pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Terms and Licenses

Depositor Comments

Depositors used delta-VPR and CMV VSV-G packaging plasmids

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW-Cas9 was a gift from Eric Lander & David Sabatini (Addgene plasmid # 50661)
  • For your References section:

    Genetic screens in human cells using the CRISPR-Cas9 system. Wang T, Wei JJ, Sabatini DM, Lander ES. Science. 2014 Jan 3;343(6166):80-4. doi: 10.1126/science.1246981. Epub 2013 Dec 12. 10.1126/science.1246981 PubMed 24336569