1
Plasmid 50661: pCW-Cas9
  • Inducible lentiviral expression of SpCas9

  • humanized S. pyogenes Cas9

  • 4300

  • 3xFLAG

  • N terminal on insert

  • pCW57.1
    (Search Vector Database)

  • Mammalian Expression, Lentiviral, CRISPR

  • 7600

  • Tet ON

  • NheI

  • No

  • BamHI

  • No

  • AGCTCGTTTAGTGAACCGTCAGATC List of Sequencing Primers

  • CACATTCTTCACGTCCGTTC

  • Ampicillin

  • Stbl3

  • 37

  • Unknown

  • Puromycin

  • human codon optimized 3XFLAG-SpCas9 was cloned from Plasmid 42230: pX330-U6-Chimeric_BB-CBh-hSpCas9

  • View sequences (8)
  • Eric Lander

  • David Sabatini

  • UBMTA

Comments: 

Depositors used delta-VPR and CMV VSV-G packaging plasmids

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Genetic screens in human cells using the CRISPR-Cas9 system. Wang et al (Science. 2014 Jan 3;343(6166):80-4. doi: 10.1126/science.1246981. Epub 2013 Dec 12. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 50661" in your Materials and Methods section.