-
PurposeDoxycycline-inducible lentiviral expression of SpCas9
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50661 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCW57.1
- Backbone size w/o insert (bp) 7600
- Total vector size (bp) 11900
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehumanized S. pyogenes Cas9
-
Insert Size (bp)4300
- Promoter Tet ON
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer CACATTCTTCACGTCCGTTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhuman codon optimized 3XFLAG-SpCas9 was cloned from Plasmid 42230: pX330-U6-Chimeric_BB-CBh-hSpCas9
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Depositors used delta-VPR and CMV VSV-G packaging plasmids
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW-Cas9 was a gift from Eric Lander & David Sabatini (Addgene plasmid # 50661 ; http://n2t.net/addgene:50661 ; RRID:Addgene_50661) -
For your References section:
Genetic screens in human cells using the CRISPR-Cas9 system. Wang T, Wei JJ, Sabatini DM, Lander ES. Science. 2014 Jan 3;343(6166):80-4. doi: 10.1126/science.1246981. Epub 2013 Dec 12. 10.1126/science.1246981 PubMed 24336569