This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #50661)


Item Catalog # Description Quantity Price (USD)
Plasmid 50661 Plasmid sent as bacteria in agar stab 1 $65
Concentrated Lentiviral Prep 50661-LVC Virus (50 µL at titer ≥ 1×10⁶ TU/mL)
and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 7600
  • Total vector size (bp) 11900
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    humanized S. pyogenes Cas9
  • Insert Size (bp)
  • Promoter Tet ON
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer CACATTCTTCACGTCCGTTC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Depositors used delta-VPR and CMV VSV-G packaging plasmids

Information for Concentrated Lentiviral Prep (Catalog # 50661-LVC) ( Back to top )


Ready-to-use Concentrated Lentiviral Prep particles produced from pCW-Cas9 (#50661). In addition to the viral particles, you will also receive purified pCW-Cas9 plasmid DNA.

Concentrated lentiviral particles carrying doxycycline-inducible pCW-Cas9.


  • Volume 50 µL
  • Titer ≥1×10⁶ TU/mL
  • Pricing $360 USD for preparation of 50 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer PBS
  • Selectable Marker Puromycin
  • Purification Lentivirus was concentrated by precipitation in polyethylene glycol (PEG) followed by centrifugation.


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Colony formation assay: A549 cells were transduced with serial dilutions of 50661-LVC and treated with puromycin. Puromycin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet, and counted.
  • PCR confirmation of insert: PCR was carried out with primers targeting the Cas9 and puromycin resistance genes. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: SpCas9-F2, GATGAAGAACTACTGGCGGC
    Reverse Primer: puro-variant-R, GTGGGCTTGTACTCGGTCAT
  • Confirmation of protein expression: HeLa cells were transduced with 50661-LVC at an MOI of 1 and selected with puromycin. Puromycin-resistant cells were left untreated or induced with doxycycline for 72 hours and collected, lysed, and tested for Cas9 expression via immunoblotting. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW-Cas9 was a gift from Eric Lander & David Sabatini (Addgene plasmid # 50661)
  • For your References section:

    Genetic screens in human cells using the CRISPR-Cas9 system. Wang T, Wei JJ, Sabatini DM, Lander ES. Science. 2014 Jan 3;343(6166):80-4. doi: 10.1126/science.1246981. Epub 2013 Dec 12. 10.1126/science.1246981 PubMed 24336569