This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #52962)


Item Catalog # Description Quantity Price (USD)
Plasmid 52962 Standard format: Plasmid sent in bacteria as agar stab 1 $65
Lentiviral Prep 52962-LV Virus (1mL at titer > 1x10⁵ TU/mL) and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 10130
  • Total vector size (bp) 12860
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Use SapI digest to check for unwanted recombination of lentiviral plasmid. Only amplify in RecA- bacteria (eg. Stbl3).
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Alt name
    S. pyogenes CRISPR-Cas9
  • Species
  • Insert Size (bp)
  • Promoter EFS-NS
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI, XbaI, AfeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer pLLU-F (5'-gggacagcagagatccagtt-3')
  • 3′ sequencing primer blast-R (5'-gctctttcaatgagggtgga-3'​)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Blasticidin resistance
  • Alt name
    blasticidin S deaminase
  • Alt name
  • Insert Size (bp)
  • Promoter EFS-NS

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer needs custom
  • 3′ sequencing primer WPRE-R
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check for the most up-to-date information.

Information for Lentiviral Prep (Catalog # 52962-LV) ( Back to top )


Ready-to-use Lentiviral Prep particles produced from lentiCas9-Blast (#52962). In addition to the viral particles, you will also receive purified lentiCas9-Blast plasmid DNA.

Lentiviral particles carrying Cas9 and blasticidin resistance. This virus is used to make stable cell lines expressing Cas9.


  • Volume 1mL
  • Titer ≥1x10⁵ TU/mL
  • Pricing $100 USD for preparation of 1mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer OptiPro
  • Selectable Marker Blasticidin


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Colony formation assay: A549 cells were transduced with serial dilutions of 52962-LV and treated with blasticidin. Blasticidin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet, and counted.
  • PCR confirmation of insert: PCR was carried out on the viral preparation with primers targeting Cas9 and the blasticidin-resistance gene. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: dCas9-F2 CCAAAGAGGTGCTGGACG
    Reverse Primer: Blast-R GCTCTTTCAATGAGGGTGGA
  • Confirmation of protein expression: A549 cells were transduced with serial dilutions of 52962-LV and treated with blasticidin. Polyclonal pools of blasticidin-resistant cells were expanded, collected, lysed and tested for Cas9 expression via immunoblotting. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Visit our viral production page for more information.

Addgene Comments

While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/mL, titers for large or toxic inserts, such as for Cas9, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from Cas9 should expect similarly low titers.

To demonstrate that Addgene’s virus is fully functional, Addgene has generated stable cell lines from the Cas9-expressing lentiviruses. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCas9-Blast was a gift from Feng Zhang (Addgene plasmid # 52962 ; ; RRID:Addgene_52962)

    For viral preps, please replace (Addgene plasmid # 52962) in the above sentence with: (Addgene viral prep # 52962-LV)

  • For your References section:

    Improved vectors and genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nat Methods. 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047. 10.1038/nmeth.3047 PubMed 25075903