Plasmid 50662: pLX-sgRNA
  • Lentiviral expression of AAVS1-targeting sgRNA; insert can be replaced with custom sgRNA (see protocol)

  • sgAAVS1

  • 450

  • pLX304
    (Search Vector Database)

  • Mammalian Expression, Lentiviral, CRISPR

  • 7000

  • U6

  • XhoI

  • No

  • NheI

  • No

  • cgggtttattacagggacagcag List of Sequencing Primers

  • taccagtcaatctttcacaaattttgt

  • Ampicillin

  • Stbl3

  • 37

  • Unknown

  • Blasticidin

  • sgAAVS1 was cloned from Plasmid 41818: gRNA_AAVS1-T2

  • View sequences (4)
  • Individual sgRNA cloning protocol (application/x-pdf)

  • Eric Lander

  • David Sabatini



For more information on OE-PCR please see: http://en.wikipedia.org/wiki/Overlap_extension_...)

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Genetic screens in human cells using the CRISPR-Cas9 system. Wang et al (Science. 2014 Jan 3;343(6166):80-4. doi: 10.1126/science.1246981. Epub 2013 Dec 12. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 50662" in your Materials and Methods section.