pLX-sgRNA
(Plasmid #50662)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pLX304
  • Backbone size w/o insert (bp) 7000
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Sequence Information

Gene/Insert

  • Gene/Insert name
    sgAAVS1
  • Insert Size (bp)
    450
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer cgggtttattacagggacagcag
  • 3′ sequencing primer taccagtcaatctttcacaaattttgt
  • (Common Sequencing Primers)

Resource Information

  • Supplemental documents
  • A portion of this plasmid was derived from a plasmid made by
    sgAAVS1 was cloned from Plasmid 41818: gRNA_AAVS1-T2
  • Terms and Licenses

Depositor Comments

For more information on OE-PCR please see: http://en.wikipedia.org/wiki/Overlap_extension_polymerase_chain_reaction)

gRNA target sequence GGGGCCACTAGGGACAGGAT

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX-sgRNA was a gift from Eric Lander & David Sabatini (Addgene plasmid # 50662)
  • For your References section:

    Genetic screens in human cells using the CRISPR-Cas9 system. Wang T, Wei JJ, Sabatini DM, Lander ES. Science. 2014 Jan 3;343(6166):80-4. doi: 10.1126/science.1246981. Epub 2013 Dec 12. 10.1126/science.1246981 PubMed 24336569