-
PurposeLentiviral expression of AAVS1-targeting sgRNA; insert can be replaced with custom sgRNA (see protocol)
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50662 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLX304
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 7500
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgAAVS1
-
Insert Size (bp)450
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer cgggtttattacagggacagcag
- 3′ sequencing primer taccagtcaatctttcacaaattttgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bysgAAVS1 was cloned from Plasmid 41818: gRNA_AAVS1-T2
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on OE-PCR please see: http://en.wikipedia.org/wiki/Overlap_extension_polymerase_chain_reaction)
gRNA target sequence GGGGCCACTAGGGACAGGAT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX-sgRNA was a gift from Eric Lander & David Sabatini (Addgene plasmid # 50662 ; http://n2t.net/addgene:50662 ; RRID:Addgene_50662) -
For your References section:
Genetic screens in human cells using the CRISPR-Cas9 system. Wang T, Wei JJ, Sabatini DM, Lander ES. Science. 2014 Jan 3;343(6166):80-4. doi: 10.1126/science.1246981. Epub 2013 Dec 12. 10.1126/science.1246981 PubMed 24336569