Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #112617)


Item Catalog # Description Quantity Price (USD)
Plasmid 112617 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    promoterless backbone from pd2EGFP-1
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 3110
  • Total vector size (bp) 8840
  • Vector type
    Mammalian Expression ; Promoterless vector, ready for promoter for mammalian expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Alt name
    HIST1H2BB, H2B.1, H2B/f, H2BFF, MGC119804
  • Alt name
  • Species
    H. sapiens (human); Anthozoa
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    H2BC3 (a.k.a. H2B.1, H2B/f, H2BFF, HIST1H2BB)
  • Promoter No Promoter
  • Tag / Fusion Protein
    • tdTomato (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAAGAATTCATGAGGCCGGCC
  • 3′ sequencing primer TGAAGTTAGTAGCTCCGCTTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Alt name
  • Alt name
  • Species
    Coccidioides posadasii C735 delta SOWgp
  • Insert Size (bp)
  • GenBank ID
  • Promoter No Promoter

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atgaaaaagcctgaactcaccgc
  • 3′ sequencing primer ttcctttgccctcggacga
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Cre-ERT2 fusion protein
  • Species
    Bacteriophage P1
  • Insert Size (bp)
  • Promoter No Promoter

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGTCCAATTTACTGACCGTACA
  • 3′ sequencing primer TCAAGCTGTGGCAGGGAAACC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    H2B was cloned from Addgene plasmid 26750, tdTomato was cloned from Addgene plasmid 26123, HygroR was cloned from Addgene plasmid 28226, CreERT2 and Rabbit betaglobin PolyA were cloned from Addgene plasmid 14797
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Promoterless multicistronic reporter plasmid containing H2BtdTomato, HygroR, and CreERT2 in a single ORF with two P2A sequences.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ptdTHC was a gift from Stefan Heller (Addgene plasmid # 112617 ; ; RRID:Addgene_112617)
  • For your References section:

    Fbxo2(VHC) mouse and embryonic stem cell reporter lines delineate in vitro-generated inner ear sensory epithelia cells and enable otic lineage selection and Cre-recombination. Hartman BH, Bscke R, Ellwanger DC, Keymeulen S, Scheibinger M, Heller S. Dev Biol. 2018 Sep 1. pii: S0012-1606(18)30499-8. doi: 10.1016/j.ydbio.2018.08.013. 10.1016/j.ydbio.2018.08.013 PubMed 30179592