-
PurposeThe tet-responsive reporter pBI-MCS-EGFP (Addgene plasmid 16542) was modified to express YFP instead of GFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58855 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBI-MCS-EGFP
- Backbone size w/o insert (bp) 4401
- Total vector size (bp) 5121
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameenhanced yellow fluorescent protein
-
Alt nameEYFP
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ttacttgtacagctcgtccat
- 3′ sequencing primer atggtgagcaagggcgaggag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBackbone is addgene plasmid 16542, pBI-MCS-EGFP
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBI-MCS-EYFP was a gift from Joshua Leonard (Addgene plasmid # 58855 ; http://n2t.net/addgene:58855 ; RRID:Addgene_58855) -
For your References section:
Modular Extracellular Sensor Architecture for Engineering Mammalian Cell-based Devices. Daringer NM, Dudek RM, Schwarz KA, Leonard JN. ACS Synth Biol. 2014 Mar 11. 10.1021/sb400128g PubMed 24611683