pcDNA4/TO-bio-myc-NES-EGFP
(Plasmid
#112712)
-
PurposeFor tetracycline-inducible expression of bio-myc-NES-EGFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112712 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA4/TO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5078
- Total vector size (bp) 6185
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
Alt nameEnhanced green fluorescence protein
-
SpeciesAequorea victoria
-
Insert Size (bp)1107
-
MutationNucleotide sequence optimized for synthetic gene production
- Promoter CMV with Tet repressor binding sites
-
Tags
/ Fusion Proteins
- biotinylation signal peptide (Tagwerker et al. 2006 Mol Cell Proteomics, 10.1074/mcp.M500368-MCP200) (N terminal on insert)
- myc tag (N terminal on insert)
- HIV Rev nuclear localization signal (NES) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer pcDNA4TO-CMV-F (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer pcDNA4TO-R (AGCATGCCTGCTATTGTCTTCCCA) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byInsert was synthesized as a gBlock by Integrated DNA Technologies
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The N-terminal tag sequence of this insert is exactly the same as in pcDNA4/TO-bio-myc-cCE, thus providing a specificity control for pulldown assays.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA4/TO-bio-myc-NES-EGFP was a gift from Daniel Schoenberg (Addgene plasmid # 112712 ; http://n2t.net/addgene:112712 ; RRID:Addgene_112712) -
For your References section:
RNA-binding proteins and heat-shock protein 90 are constituents of the cytoplasmic capping enzyme interactome. Trotman JB, Agana BA, Giltmier AJ, Wysocki VH, Schoenberg DR. J Biol Chem. 2018 Oct 26;293(43):16596-16607. doi: 10.1074/jbc.RA118.004973. Epub 2018 Aug 30. 10.1074/jbc.RA118.004973 PubMed 30166341