Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

7i sgRNA for 4-μHOM reporter
(Plasmid #113626)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 113626 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    7i sgRNA
  • gRNA/shRNA sequence
  • Species

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs1 (destroyed during cloning)
  • 3′ cloning site Bbs1 (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    7i sgRNA for 4-μHOM reporter was a gift from Jeremy Stark (Addgene plasmid # 113626 ; ; RRID:Addgene_113626)
  • For your References section:

    C-NHEJ without indels is robust and requires synergistic function of distinct XLF domains. Bhargava R, Sandhu M, Muk S, Lee G, Vaidehi N, Stark JM. Nat Commun. 2018 Jun 27;9(1):2484. doi: 10.1038/s41467-018-04867-5. 10.1038/s41467-018-04867-5 [pii] PubMed 29950655