-
Purpose(Empty Backbone) Retroviral construct for miRNA expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 11375 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMDH1-PGK-GFP 2.0
- Backbone size (bp) 6963
-
Vector typeMammalian Expression, Retroviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer EGFP-C
- 3′ sequencing primer ggatcccaatatttgcatgtcgc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MDH1-PGK-GFP_2.0 was a gift from Chang-Zheng Chen (Addgene plasmid # 11375 ; http://n2t.net/addgene:11375 ; RRID:Addgene_11375) -
For your References section:
MicroRNAs modulate hematopoietic lineage differentiation. Chen CZ, Li L, Lodish HF, Bartel DP. Science. 2004 Jan 2. 303(5654):83-6. 10.1126/science.1091903 PubMed 14657504