MDH1-PGK-GFP microRNA-10b
(Plasmid #16070)

Available to Academic and Nonprofits Only


  • Vector backbone
    MDH1-PGK-GFP 2.0
  • Backbone size w/o insert (bp) 6963
  • Vector type
    Mammalian Expression, Retroviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    MIR10B (a.k.a. MIRN10B, hsa-mir-10b, miRNA10B, mir-10b)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer EGFP-C
  • 3′ sequencing primer ggatcccaatatttgcatgtcgc
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The miRNA gene was PCR-amplified from normal human genomic DNA and cloned into the MDH1-PGK-GFP 2.0 retroviral vector. It includes miR-10b stem-loop and ~100bp flanking sequences on both sides.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MDH1-PGK-GFP microRNA-10b was a gift from Bob Weinberg (Addgene plasmid # 16070)
  • For your References section:

    Tumour invasion and metastasis initiated by microRNA-10b in breast cancer. Ma L, Teruya-Feldstein J, Weinberg RA. Nature. 2007 Oct 11. 449(7163):682-8. 10.1038/nature06174 PubMed 17898713