Holiday Schedule: Addgene will be closed December 22nd & 25th and January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

MDH1-PGK-GFP microRNA-10b
(Plasmid #16070)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 16070 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    MDH1-PGK-GFP 2.0
  • Backbone size w/o insert (bp) 6963
  • Vector type
    Mammalian Expression, Retroviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    MIR10B (a.k.a. MIRN10B, hsa-mir-10b, miRNA10B, mir-10b)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer EGFP-C
  • 3′ sequencing primer ggatcccaatatttgcatgtcgc
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The miRNA gene was PCR-amplified from normal human genomic DNA and cloned into the MDH1-PGK-GFP 2.0 retroviral vector. It includes miR-10b stem-loop and ~100bp flanking sequences on both sides.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MDH1-PGK-GFP microRNA-10b was a gift from Bob Weinberg (Addgene plasmid # 16070)
  • For your References section:

    Tumour invasion and metastasis initiated by microRNA-10b in breast cancer. Ma L, Teruya-Feldstein J, Weinberg RA. Nature. 2007 Oct 11. 449(7163):682-8. 10.1038/nature06174 PubMed 17898713