Plasmid 16070: MDH1-PGK-GFP microRNA-10b
  • microRNA-10b

  • miR-10b

  • 315

  • H. sapiens (human)

  • MIR10B (MIRN10B, hsa-mir-10b, miRNA10B, mir-10b)

  • MDH1-PGK-GFP 2.0
    (Search Vector Database)

  • Mammalian Expression, Retroviral, RNAi

  • 6963

  • EcoRI

  • No

  • XhoI

  • No

  • EGFP-C List of Sequencing Primers

  • ggatcccaatatttgcatgtcgc

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • Bob Weinberg

    Ancillary Agreement for Plasmids Containing FP Materials


The miRNA gene was PCR-amplified from normal human genomic DNA and cloned into the MDH1-PGK-GFP 2.0 retroviral vector. It includes miR-10b stem-loop and ~100bp flanking sequences on both sides.

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Tumour invasion and metastasis initiated by microRNA-10b in breast cancer. Ma et al (Nature. 2007 Oct 11. 449(7163):682-8. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 16070" in your Materials and Methods section.