1
Plasmid 11375: MDH1-PGK-GFP_2.0
  • None

  • MDH1-PGK-GFP 2.0
    (Search Vector Database)

  • Mammalian Expression, Retroviral, RNAi

  • 6963

  • EGFP-C List of Sequencing Primers

  • ggatcccaatatttgcatgtcgc

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (3)
  • View map

  • Chang-Zheng Chen

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: MicroRNAs modulate hematopoietic lineage differentiation. Chen et al (Science. 2004 Jan 2. 303(5654):83-6. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 11375" in your Materials and Methods section.