Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUDR211
(Plasmid #113870)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113870 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pROS14 (#107928)
  • Backbone size w/o insert (bp) 6632
  • Total vector size (bp) 6632
  • Modifications to backbone
    Replacement of the two CAN1 sgRNA target with HXT8 and 14 sgRNA target
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA3-HXT8 / sgRNA4-HXT14
  • gRNA/shRNA sequence
    GAAATAATCACATAACATAC / ATAATAAATTCAAATGTGTT
  • Species
    S. cerevisiae (budding yeast)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone of the pMEL and pROS series was derived from p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene # 43803).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The pROS14 bacbone plasmid is described in "CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. Mans R, van Rossum HM, Wijsman M, Backx A, Kuijpers NG, van den Broek M, Daran-Lapujade P, Pronk JT, van Maris AJ, Daran JM. FEMS Yeast Res. 2015 Mar;15(2). pii: fov004. doi: 10.1093/femsyr/fov004. Epub 2015 Mar 4. 10.1093/femsyr/fov004 PubMed 25743786"

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUDR211 was a gift from Jean-Marc Daran & Jack Pronk (Addgene plasmid # 113870 ; http://n2t.net/addgene:113870 ; RRID:Addgene_113870)
  • For your References section:

    A toolkit for rapid CRISPR-SpCas9 assisted construction of hexose-transport-deficient Saccharomyces cerevisiae strains. Wijsman M, Swiat MA, Marques WL, Hettinga JK, van den Broek M, Torre Cortes P, Mans R, Pronk JT, Daran JM, Daran-Lapujade P. FEMS Yeast Res. 2019 Jan 1;19(1). pii: 5114578. doi: 10.1093/femsyr/foy107. 10.1093/femsyr/foy107 PubMed 30285096