Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #114120)


Item Catalog # Description Quantity Price (USD)
Plasmid 114120 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Addgene #41393
  • Backbone size w/o insert (bp) 7711
  • Total vector size (bp) 11146
  • Vector type
    Mammalian Expression, Lentiviral ; Doxycycline inducible
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    SHLD2 (m1 mutant)
  • Alt name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    W489A, F494A, W495A mutations introduced
  • Entrez Gene
    SHLD2 (a.k.a. FAM35A, FAM35A1, RINN2, bA163M19.1)
  • Promoter TRE promoter, Tet ON
  • Tag / Fusion Protein
    • eGFP (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW-eGFP-SHLD2-m1 was a gift from Daniel Durocher (Addgene plasmid # 114120 ; ; RRID:Addgene_114120)
  • For your References section:

    The shieldin complex mediates 53BP1-dependent DNA repair. Noordermeer SM, Adam S, Setiaputra D, Barazas M, Pettitt SJ, Ling AK, Olivieri M, Alvarez-Quilon A, Moatti N, Zimmermann M, Annunziato S, Krastev DB, Song F, Brandsma I, Frankum J, Brough R, Sherker A, Landry S, Szilard RK, Munro MM, McEwan A, Goullet de Rugy T, Lin ZY, Hart T, Moffat J, Gingras AC, Martin A, van Attikum H, Jonkers J, Lord CJ, Rottenberg S, Durocher D. Nature. 2018 Aug;560(7716):117-121. doi: 10.1038/s41586-018-0340-7. Epub 2018 Jul 18. 10.1038/s41586-018-0340-7 PubMed 30022168