Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Ai133 (TITL-ssAPEX2tm) targeting vector
(Plasmid #114432)


Item Catalog # Description Quantity Price (USD)
Plasmid 114432 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    TIGRE1.0 targeting vector
  • Backbone size w/o insert (bp) 11443
  • Total vector size (bp) 12254
  • Vector type
    Mouse Targeting, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Insert Size (bp)
  • Promoter TREtight

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Mlul... (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer CTAATTCCATCAGAAAGCTT
  • 3′ sequencing primer CTAATTCCATCAGAAAGCTT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Alice Ting
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ai133 (TITL-ssAPEX2tm) targeting vector was a gift from Hongkui Zeng (Addgene plasmid # 114432 ; ; RRID:Addgene_114432)
  • For your References section:

    A Suite of Transgenic Driver and Reporter Mouse Lines with Enhanced Brain-Cell-Type Targeting and Functionality. Daigle TL, Madisen L, Hage TA, Valley MT, Knoblich U, Larsen RS, Takeno MM, Huang L, Gu H, Larsen R, Mills M, Bosma-Moody A, Siverts LA, Walker M, Graybuck LT, Yao Z, Fong O, Nguyen TN, Garren E, Lenz GH, Chavarha M, Pendergraft J, Harrington J, Hirokawa KE, Harris JA, Nicovich PR, McGraw MJ, Ollerenshaw DR, Smith KA, Baker CA, Ting JT, Sunkin SM, Lecoq J, Lin MZ, Boyden ES, Murphy GJ, da Costa NM, Waters J, Li L, Tasic B, Zeng H. Cell. 2018 Jul 12;174(2):465-480.e22. doi: 10.1016/j.cell.2018.06.035. 10.1016/j.cell.2018.06.035 PubMed 30007418