pT2K-CAGGS-U6-sgRNA-M7-IRES-CFP
(Plasmid
#114730)
-
PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114730 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepT2K-CAGGS-IRES-CFP
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersCFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA M7
-
gRNA/shRNA sequenceaaatagagagaggtggggaa
-
SpeciesM. musculus (mouse)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT2K-CAGGS-U6-sgRNA-M7-IRES-CFP was a gift from Martine Roussel (Addgene plasmid # 114730 ; http://n2t.net/addgene:114730 ; RRID:Addgene_114730) -
For your References section:
Mouse medulloblastoma driven by CRISPR activation of cellular Myc. Vo BT, Kwon JA, Li C, Finkelstein D, Xu B, Orr BA, Sherr CJ, Roussel MF. Sci Rep. 2018 Jun 7;8(1):8733. doi: 10.1038/s41598-018-24956-1. 10.1038/s41598-018-24956-1 [pii] PubMed 29880921