pSec7-iGFPx6
(Plasmid
#115424)
-
PurposeExpress Sec7-iGFPx6 at the endogenous locus via pop-in pop-out mutagenesis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115424 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneYIplac211
- Total vector size (bp) 10447
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSec7-iGFPx6
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)4139
- Promoter Endogenous
-
Tag
/ Fusion Protein
- iGFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer GTAAAACGACGGCCAGT
- 3′ sequencing primer CACACAGGAAACAGCTATGACCAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note sequence is from JK93da yeast strain rather than S288C
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSec7-iGFPx6 was a gift from Benjamin Glick (Addgene plasmid # 115424 ; http://n2t.net/addgene:115424 ; RRID:Addgene_115424) -
For your References section:
Maturation-driven transport and AP-1-dependent recycling of a secretory cargo in the Golgi. Casler JC, Papanikou E, Barrero JJ, Glick BS. J Cell Biol. 2019 May 6;218(5):1582-1601. doi: 10.1083/jcb.201807195. Epub 2019 Mar 11. 10.1083/jcb.201807195 PubMed 30858194