YIplac204-pOst1-APVNTA-DsRed-Express2-FKBP(LV)(C22V)
(Plasmid
#115428)
-
PurposeExpresses a non-glycosylated regulatable secretory cargo for yeast at the TRP1 locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115428 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneYIplac204
- Backbone size w/o insert (bp) 4094
- Total vector size (bp) 5183
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepOst1-APVNTA-DsRed-Express2-FKBP(LV)(C22V)
-
Alt nameAT73
- Promoter TPI1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer CCTTTGGCTCGGCTGCTG
- 3′ sequencing primer CATGCGTACACGCGTCTGTAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YIplac204-pOst1-APVNTA-DsRed-Express2-FKBP(LV)(C22V) was a gift from Benjamin Glick (Addgene plasmid # 115428 ; http://n2t.net/addgene:115428 ; RRID:Addgene_115428) -
For your References section:
Maturation-driven transport and AP-1-dependent recycling of a secretory cargo in the Golgi. Casler JC, Papanikou E, Barrero JJ, Glick BS. J Cell Biol. 2019 May 6;218(5):1582-1601. doi: 10.1083/jcb.201807195. Epub 2019 Mar 11. 10.1083/jcb.201807195 PubMed 30858194