pNJP
(Plasmid
#115494)
-
PurposeExpression vector for NLS-iRFP-NLS, JNK KTR-mCherry, and mKO-MK2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115494 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPB
-
Backbone manufacturerAllan Bradley (Wellcome Sanger Institute)
- Backbone size w/o insert (bp) 6804
- Total vector size (bp) 10722
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-iRFP-NLS-P2A-JNK KTR-mCherry-P2A-mKO-MK2
-
Alt nameNJP (Nuclear, JNK, and p38 reporter)
-
SpeciesH. sapiens (human), M. musculus (mouse), Synthetic
-
Insert Size (bp)3918
-
MutationmCherry S227F, mCherry G229R, mKO V211G
-
Entrez GeneMAPK14 (a.k.a. CSBP, CSBP1, CSBP2, CSPB1, EXIP, Mxi2, PRKM14, PRKM15, RK, SAPK2A, p38, p38ALPHA)
-
Entrez GeneMAPK8 (a.k.a. JNK, JNK-46, JNK1, JNK1A2, JNK21B1/2, PRKM8, SAPK1, SAPK1c)
- Promoter CAG
-
Tags
/ Fusion Proteins
- mCherry (C terminal on insert)
- mKO (N terminal on insert)
- iRFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer catgttcatgccttcttctttttcc
- 3′ sequencing primer gggccctcacattgccaaa (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMarkus Covert (Stanford University)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For JNK KTR, see also: Regot et al Cell. 2014 Jun 19;157(7):1724-34. doi: 10.1016/j.cell.2014.04.039.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNJP was a gift from Kazuhiro Aoki (Addgene plasmid # 115494 ; http://n2t.net/addgene:115494 ; RRID:Addgene_115494) -
For your References section:
Cell-to-Cell Heterogeneity in p38-Mediated Cross-Inhibition of JNK Causes Stochastic Cell Death. Miura H, Kondo Y, Matsuda M, Aoki K. Cell Rep. 2018 Sep 4;24(10):2658-2668. doi: 10.1016/j.celrep.2018.08.020. 10.1016/j.celrep.2018.08.020 PubMed 30184500