Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #115652)


Item Catalog # Description Quantity Price (USD)
Plasmid 115652 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Agilent technologies
  • Backbone size w/o insert (bp) 2907
  • Total vector size (bp) 7416
  • Vector type
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    Homology region 1
  • Entrez Gene
    TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site NdeI (not destroyed)
  • 3′ sequencing primer TAGGGCGCGATAACTTCGTA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    Homology region 2
  • Entrez Gene
    TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GGGAGGATTGGGAAGACAAT
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Tag / Fusion Protein
    • T2A

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 3′ sequencing primer TAGGGCGCGATAACTTCGTA
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
  • Species
    E. coli
  • Tag / Fusion Protein
    • BirA*

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ACATATTTGCATGGGGTGTG
  • 3′ sequencing primer TAGGGCGCGATAACTTCGTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAav-TP53-T2A-BirA* was a gift from Sven Eyckerman (Addgene plasmid # 115652 ; ; RRID:Addgene_115652)
  • For your References section:

    A well-controlled BioID design for endogenous bait proteins. Vandemoortele G, Sutter DD, Moliere A, Pauwels J, Gevaert K, and Eyckerman S.. bioRxiv (2018) 10.1101/427807