pCAGGs-NLS-TIR1_P2A_NES-TIR1
(Plasmid
#117699)
-
PurposeExpression of NLS-(Os)TIR1-HA and Myc-NES-(Os)TIR1from one mRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117699 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonecustom
-
Backbone manufacturerFrancis Stewart
- Backbone size w/o insert (bp) 6399
- Total vector size (bp) 10062
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTRANSPORT INHIBITOR RESPONSE 1
-
Alt nameTIR1
-
SpeciesOryza sativa
-
Insert Size (bp)1794
-
Mutationcodon optimized for murine expression
- Promoter chicken beta-actin promoter
-
Tags
/ Fusion Proteins
- HA tag (C terminal on insert)
- NLS (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer unknown
- 3′ sequencing primer unknown (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTRANSPORT INHIBITOR RESPONSE 1
-
Alt nameTIR1
-
SpeciesOryza sativa
-
Insert Size (bp)1794
-
Mutationcodon optimized for murine expression
- Promoter None, 2A peptide from porcine teschovirus-1 polyprotein
-
Tag
/ Fusion Protein
- Myc-NES (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsrG1 (not destroyed)
- 3′ cloning site BsrG1 (not destroyed)
- 5′ sequencing primer GGCTACCCATACGATGTTCC
- 3′ sequencing primer ATGGTGGAAAATAACATATAGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byWe received the backbone containing NLS-Tir1 from Francis Stewart (TU Dresden, BIOTEC Institute, Tatzberg 47-49, 01307 Dresden, Germany
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The codon optimized NLS-TIR1 is described in:
Baker, O. et al. RAC-tagging: Recombineering And Cas9-assisted targeting for protein tagging and conditional analyses. Sci Rep 6, 25529 (2016).
Some ambiguous bases and differences are present between the depositor sequence and Addgene's NGS sequence, but they are not expected to impact plasmid functionality.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGs-NLS-TIR1_P2A_NES-TIR1 was a gift from Joerg Mansfeld (Addgene plasmid # 117699 ; http://n2t.net/addgene:117699 ; RRID:Addgene_117699) -
For your References section:
Conditional control of fluorescent protein degradation by an auxin-dependent nanobody. Daniel K, Icha J, Horenburg C, Muller D, Norden C, Mansfeld J. Nat Commun. 2018 Aug 17;9(1):3297. doi: 10.1038/s41467-018-05855-5. 10.1038/s41467-018-05855-5 [pii] PubMed 30120238