pET28a-SdrG_N2N3-B1-B2-HIS-ybbr
(Plasmid
#117979)
-
PurposeSdrG N2 and N3, B1 and B2 domains with C-terminal ybbr tag for covalent immobilization
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117979 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5216
- Total vector size (bp) 6983
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSdrG_N2N3-B1-B2
-
Alt nameStaphylococcus epidermidis fibrinogen-binding protein SD-repeat protein G
-
SpeciesStaphylococcus epidermidis
-
Insert Size (bp)1767
-
GenBank IDAF245042
- Promoter T7
-
Tags
/ Fusion Proteins
- H3V 3C (C terminal on insert)
- HIS (C terminal on insert)
- ybbr (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CTAGTTATTGCTCAGCGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-SdrG_N2N3-B1-B2-HIS-ybbr was a gift from Hermann Gaub (Addgene plasmid # 117979 ; http://n2t.net/addgene:117979 ; RRID:Addgene_117979) -
For your References section:
Calcium stabilizes the strongest protein fold. Milles LF, Unterauer EM, Nicolaus T, Gaub HE. Nat Commun. 2018 Nov 12;9(1):4764. doi: 10.1038/s41467-018-07145-6. 10.1038/s41467-018-07145-6 PubMed 30420680