Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pN_35S/mCitrine
(Plasmid #117994)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 117994 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pN_35S
  • Backbone size w/o insert (bp) 9228
  • Total vector size (bp) 9948
  • Modifications to backbone
    pB2GW7 backbone modified to replace bialaphos (BASTA) resistance gene (bar) with a nourseothricin resistance gene
  • Vector type
    Plant Expression ; Plant/bacteria binary vector
  • Selectable markers
    Nourseothricin/streptothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mCitrine
  • Species
    Synthetic
  • Insert Size (bp)
    1041
  • Promoter Cauliflower mosaic virus 35S

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCGGATTCCATTGCCCAGCTAT
  • 3′ sequencing primer ATATGCTCAACACATGAGCGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The mCitrine coding sequence was originally obtained from the pET mCitrine LIC cloning vector (a gift from Scott Gradia (Addgene plasmid # 29771)).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pN_35S/mCitrine was a gift from Mathias Pribil (Addgene plasmid # 117994 ; http://n2t.net/addgene:117994 ; RRID:Addgene_117994)
  • For your References section:

    Membrane-bound protein scaffolding in diverse hosts using thylakoid protein CURT1A. Behrendorff JBYH, Sandoval-Ibanez OA, Sharma A, Pribil M. ACS Synth Biol. 2019 Mar 18. doi: 10.1021/acssynbio.8b00418. 10.1021/acssynbio.8b00418 PubMed 30884945