-
Purpose(Empty Backbone) Used for expression of sgRNA in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 118055 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene#62988)
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer AGCTGGGAGGCGACAAAAGG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
pSpCas9(BB)-2A-Puro (PX459) V2.0 was digested with EcoRI to remove the T2A-Puro cassette, and a P2A-Blasticidin cassette was amplified by PCR, digested with EcoRI, and ligated.
The BbsI site (GAAGAC) in the blasticidin-resistance gene was mutated to GAGGAC with no change in amino acids.
gRNA inserts can be sequenced using pLKO.1 5’ primer, 5’-GACTATCATATGCTTACCGT-3’.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9(BB)-2A-Blast was a gift from Ken-Ichi Takemaru (Addgene plasmid # 118055 ; http://n2t.net/addgene:118055 ; RRID:Addgene_118055)