pAAV-EF1a-FLEX(frt)-GCaMP6f-WPRE
(Plasmid #118273)

• Purpose: pAAV vector for flippase dependent GCaMP6f expression under the control of EF1a promoter
• Depositing Lab: Naoshige Uchida
• Publication: Menegas et al Nat Neurosci. 2018 Sep 3. pii: 10.1038/s41593-018-0222-1. doi: 10.1038/s41593-018-0222-1.

Backbone

• Vector backbone: pAAV-Ef1a-fDIO EYFP
• Backbone manufacturer: K. Deisseroth lab (Stanford)
• Modifications to backbone: The EYFP gene was replaced with GCaMP6f
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GCaMP6f
• Alt name: GCaMP3-T302L R303P A317E D380Y T381R S383T R392G
• Species: R. norvegicus (rat); A. victoria (jellyfish)
• Promoter: EF1a
• Tags / Fusion Proteins:
  • 6xHis (N terminal on insert) (N terminal on insert)
  • T7 epitope (N terminal on insert)
  • Xpress tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (destroyed during cloning)
• 3′ cloning site: NheI (destroyed during cloning)
• 5′ sequencing primer: gttgcgtgagcggaaagatg
• 3′ sequencing primer: ggcattaaagcagcgtatccac

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GCaMP6f is cloned from pGP-CMV-GCaMP6f (Addgene#40755) provided by Douglas Kim. Backbone is derived from pAAV-Ef1a-fDIO EYFP (Addgene#55641) provided by Karl Deisseroth.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry