Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MiniCoopR U6:gRNA cdkn2a, mitfa:Cas9
(Plasmid #118842)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118842 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MiniCoopR
  • Vector type
    CRISPR ; Tol2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cdkn2a gRNA
  • gRNA/shRNA sequence
    GTTCTGGCAGCGTCGTGCAG
  • Species
    D. rerio (zebrafish)
  • Entrez Gene
    LOC100329528

Cloning Information

  • Cloning method Gateway Cloning

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MiniCoopR U6:gRNA cdkn2a, mitfa:Cas9 was a gift from Leonard Zon (Addgene plasmid # 118842 ; http://n2t.net/addgene:118842 ; RRID:Addgene_118842)
  • For your References section:

    Human tumor genomics and zebrafish modeling identify SPRED1 loss as a driver of mucosal melanoma. Ablain J, Xu M, Rothschild H, Jordan RC, Mito JK, Daniels BH, Bell CF, Joseph NM, Wu H, Bastian BC, Zon LI, Yeh I. Science. 2018 Nov 1. pii: science.aau6509. doi: 10.1126/science.aau6509. 10.1126/science.aau6509 PubMed 30385465