Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJMP1187
(Plasmid #119256)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 119256 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    R6Kgamma
  • Vector type
    Bacterial Expression
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    BW25141
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA NT1/RR1 (rfp)
  • gRNA/shRNA sequence
    AACTTTCAGTTTAGCGGTCT
  • Mutation
    D10A and H840A

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJMP1187 was a gift from Carol Gross & Jason Peters & Oren Rosenberg (Addgene plasmid # 119256 ; http://n2t.net/addgene:119256 ; RRID:Addgene_119256)
  • For your References section:

    Enabling genetic analysis of diverse bacteria with Mobile-CRISPRi. Peters JM, Koo BM, Patino R, Heussler GE, Hearne CC, Qu J, Inclan YF, Hawkins JS, Lu CHS, Silvis MR, Harden MM, Osadnik H, Peters JE, Engel JN, Dutton RJ, Grossman AD, Gross CA, Rosenberg OS. Nat Microbiol. 2019 Jan 7. pii: 10.1038/s41564-018-0327-z. doi: 10.1038/s41564-018-0327-z. 10.1038/s41564-018-0327-z PubMed 30617347