pC0.286
(Plasmid
#119627)
-
PurposeLevel 0 Part. CDS
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119627 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepICH41264
- Backbone size w/o insert (bp) 2247
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAbRChl
-
Insert Size (bp)1035
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer ttgagtgagctgataccgct
- 3′ sequencing primer GTCTCATGAGCGGATACATATTTGAATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
AbR cassette for Chloramphenicol.
Please note: due to an error in cloning, the 3’ overhang (GCTT) typically generated by BsaI is absent for this part, and has been changed to ATCT. Thus, this vector will not assemble as expected. The ABR cassette for Chloramphenicol is correct.
Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC0.286 was a gift from Alistair McCormick (Addgene plasmid # 119627 ; http://n2t.net/addgene:119627 ; RRID:Addgene_119627) -
For your References section:
CyanoGate: A Modular Cloning Suite for Engineering Cyanobacteria Based on the Plant MoClo Syntax. Vasudevan R, Gale GAR, Schiavon AA, Puzorjov A, Malin J, Gillespie MD, Vavitsas K, Zulkower V, Wang B, Howe CJ, Lea-Smith DJ, McCormick AJ. Plant Physiol. 2019 May;180(1):39-55. doi: 10.1104/pp.18.01401. Epub 2019 Feb 28. 10.1104/pp.18.01401 PubMed 30819783