pAG84 3'UTR
(Plasmid
#12026)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 12026 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIS2
-
Backbone manufacturerpIS2 derived from pRL-SV40 (Promega)
- Backbone size w/o insert (bp) 3700
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameN5 3'UTR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)190
-
GenBank IDAP001157
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
3'UTR mutant in renilla luciferase reporter plasmid. Wild-type microRNA recognition sites (seed matches): 20-25 and 191-196.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG84 3'UTR was a gift from David Bartel (Addgene plasmid # 12026 ; http://n2t.net/addgene:12026 ; RRID:Addgene_12026) -
For your References section:
The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP. Science. 2005 Dec 16. 310(5755):1817-21. 10.1126/science.1121158 PubMed 16308420