pLenti-CMV-GFP-Sox11
(Plasmid #120387)

• Purpose: over expression of sox11 using infection
• Depositing Lab: Igor Ulitsky
• Publication: Perry et al Mol Cell. 2018 Nov 1;72(3):553-567.e5. doi: 10.1016/j.molcel.2018.09.021. Epub 2018 Oct 25.

Backbone

• Vector backbone: pLenti CMV GFP
• Backbone size w/o insert (bp): 7424
• Total vector size (bp): 8617
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sox11
• Alt name: Mus musculus SRY (sex determining region Y)-box 11
• Species: M. musculus (mouse)
• Insert Size (bp): 1193
• GenBank ID: NM_009234.6
• Entrez Gene: Sox11 (a.k.a. 1110038H03Rik, 6230403H02Rik, AI836553, end, end1)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: CCCCATTGACGCAAATGGGCGG
• 3′ sequencing primer: AAGTCGTGCTGCTTCATGTG

Resource Information

• Supplemental Documents:
  • sox11.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry