p5T7-LYCipi-ggpps
(Plasmid
#122017)
-
PurposeExpresses genes for lycopene synthesis (crtI, crtB & ipi from Pantoea agglomerans, ggpps from T. canadiensis). IPTG inducible. Spec. resist.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122017 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepsc101
- Backbone size w/o insert (bp) 6200
- Total vector size (bp) 11922
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGGPP synthase
-
Alt nameGGPPs
-
SpeciesTaxus canadensis
-
Insert Size (bp)891
-
Mutationcodon optimized, truncated first 98 amino acids, methionine added. Please see Depositor Comments
-
GenBank IDAAD16018.1
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTAATAAGGAGATATACCATATGTTCGACTTCAACGAG
- 3′ sequencing primer TTGAACCCAAAAGGGCGGTATTAGTTTTGACGAAAGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Based on pAC-LYCipi (Addgene plasmid # 53279 ; http://n2t.net/addgene:53279 ; RRID:Addgene_53279), with backbone changed to pSC101, and crtE swapped for ggpps from Taxus canadensis (truncated & codon optimized).
Please note: The plasmid contains a 387 nucleotide deletion from Trp249 of Eh-idi to His30 of IDI-2 (when compared to the depositor's sequence) combining the two ORFs into a single ORF. This mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p5T7-LYCipi-ggpps was a gift from Gregory Stephanopoulos (Addgene plasmid # 122017 ; http://n2t.net/addgene:122017 ; RRID:Addgene_122017) -
For your References section:
Two-step pathway for isoprenoid synthesis. Chatzivasileiou AO, Ward V, Edgar SM, Stephanopoulos G. Proc Natl Acad Sci U S A. 2018 Dec 24. pii: 1812935116. doi: 10.1073/pnas.1812935116. 10.1073/pnas.1812935116 PubMed 30584096