-
PurposePlasmid for heterologous protein secretion in Lactobacillus plantarum and L. sakei
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122030 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonespp-based expression vector (pSIP401)
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 6188
-
Vector typeBacterial Expression
-
Selectable markersErythromycin
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesignal peptide Lp_3050
-
SpeciesSignal peptide from Lp_3050 gene in Lactobacillus plantarum
-
Insert Size (bp)124
- Promoter sppA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer GGCTTTTATAATATGAGATAATGCCGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid for heterologous secretion of proteins in Lactobacillus plantarum and L. sakei
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLp_3050sNuc was a gift from Vincent Eijsink & Geir Mathiesen (Addgene plasmid # 122030 ; http://n2t.net/addgene:122030 ; RRID:Addgene_122030) -
For your References section:
Genome-wide analysis of signal peptide functionality in Lactobacillus plantarum WCFS1. Mathiesen G, Sveen A, Brurberg MB, Fredriksen L, Axelsson L, Eijsink VG. BMC Genomics. 2009 Sep 10;10:425. doi: 10.1186/1471-2164-10-425. 10.1186/1471-2164-10-425 PubMed 19744343