pCP60 RS-GFP
(Plasmid
#122173)
-
Purpose"Binary vector for Agrobacterium tumefacience-mediated transformation of plant cells resulting in constitutive expression of cytoplasmatically localized RS-GFP"
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122173 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCP60 (sequence not available in databases) - derivative of pBIN19
-
Backbone manufacturerprof. Pascal Ratet (French National Centre for Scientific Research)
- Backbone size w/o insert (bp) 12400
- Total vector size (bp) 13636
-
Vector typePlant Expression ; binary vector for Escherichia coli and Agrobacterium tumefaciens-mediated plant transformation
-
Selectable markerskanamycin in plant cells
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAgrobacterium tumefaciens grow at 28°C
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRS-GFP
-
SpeciesAequorea victoria
-
Insert Size (bp)716
-
GenBank IDU70496
- Promoter CaMV 35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SmaI (destroyed during cloning)
- 5′ sequencing primer CACAATCCCACTATCCTTCG
- 3′ sequencing primer CTAGTAACATAGATGACACCG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byprof. Pascal Ratet (pCP60 vector backbone); RS-GFP gene originates from Davis, S.J. & Vierstra, R.D. Plant Mol Biol (1998) 36: 521. https://doi.org/10.1023/A:1005991617182 (kindly provided by ABRC)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCP60 RS-GFP was a gift from Lukas Fischer (Addgene plasmid # 122173 ; http://n2t.net/addgene:122173 ; RRID:Addgene_122173) -
For your References section:
Cloning of transgenic tobacco BY-2 cells; an efficient method to analyse and reduce high natural heterogeneity of transgene expression. Nocarova E, Fischer L. BMC Plant Biol. 2009 Apr 22;9:44. doi: 10.1186/1471-2229-9-44. 10.1186/1471-2229-9-44 PubMed 19386122