pCP60 RS-GFP
(Plasmid #122173)

• Purpose: "Binary vector for Agrobacterium tumefacience-mediated transformation of plant cells resulting in constitutive expression of cytoplasmatically localized RS-GFP"
• Depositing Lab: Lukas Fischer
• Publication: Nocarova et al BMC Plant Biol. 2009 Apr 22;9:44. doi: 10.1186/1471-2229-9-44.

Backbone

• Vector backbone: pCP60 (sequence not available in databases) - derivative of pBIN19
• Backbone manufacturer: prof. Pascal Ratet (French National Centre for Scientific Research)
• Backbone size w/o insert (bp): 12400
• Total vector size (bp): 13636
• Vector type: Plant Expression ; binary vector for Escherichia coli and Agrobacterium tumefaciens-mediated plant transformation
• Selectable markers: kanamycin in plant cells

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Agrobacterium tumefaciens grow at 28°C
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: RS-GFP
• Species: Aequorea victoria
• Insert Size (bp): 716
• GenBank ID: U70496
• Promoter: CaMV 35S

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SmaI (destroyed during cloning)
• 5′ sequencing primer: CACAATCCCACTATCCTTCG
• 3′ sequencing primer: CTAGTAACATAGATGACACCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: prof. Pascal Ratet (pCP60 vector backbone); RS-GFP gene originates from Davis, S.J. & Vierstra, R.D. Plant Mol Biol (1998) 36: 521. https://doi.org/10.1023/A:1005991617182 (kindly provided by ABRC)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry