HIV-dual-GT
(Plasmid
#122696)
-
PurposeDual-fluorescence reporter to monitor the expression of HIV-1 early genes and late genes simultaneously.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122696 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepNL4-3
-
Backbone manufacturerMalcolm A. Martin Lab
- Backbone size w/o insert (bp) 14825
- Total vector size (bp) 16258
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemTagBFP2
-
SpeciesSynthetic
-
Insert Size (bp)708
-
GenBank IDMH013372.1
- Promoter HIV-1 LTR
-
Tag
/ Fusion Protein
- PEST domain (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer 5' cgacccctcgtcacaagctagc 3'
- 3′ sequencing primer 5' ccctatcttctagactatta 3' (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameDsRed-max
-
SpeciesSynthetic
-
Insert Size (bp)672
-
GenBank IDFJ226078.1
- Promoter HIV-1 LTR
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer 5' agatgggtggcgcggccgct 3'
- 3′ sequencing primer 5' ttctaggtctcgagttacta 3' (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HIV-dual-GT was a gift from Klaus Überla (Addgene plasmid # 122696 ; http://n2t.net/addgene:122696 ; RRID:Addgene_122696) -
For your References section:
CRNKL1 Is a Highly Selective Regulator of Intron-Retaining HIV-1 and Cellular mRNAs. Xiao H, Wyler E, Milek M, Grewe B, Kirchner P, Ekici A, Silva ABOV, Jungnickl D, Full F, Thomas M, Landthaler M, Ensser A, Uberla K. mBio. 2021 Jan 19;12(1). pii: mBio.02525-20. doi: 10.1128/mBio.02525-20. 10.1128/mBio.02525-20 PubMed 33468685