Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMH183
(Plasmid #122856)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 122856 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMA-RQ
  • Backbone size w/o insert (bp) 2421
  • Total vector size (bp) 2703
  • Vector type
    Golden Gate compatible cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MS2-modified sgRNA targeting the Arabidopsis FT promoter
  • gRNA/shRNA sequence
    ggatttgcattaactcgggt
  • Species
    Synthetic

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid is designed for Golden Gate cloning using the enzyme BsaI.

Plasmid Features (listed as bp in full plasmid sequence):
BsaI site #1 = 2241-2246bp
sgRNA-FT-A sequence = 2382-2541bp
BsaI site #2 = 2553-2558bp

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMH183 was a gift from Markus Schmid (Addgene plasmid # 122856 ; http://n2t.net/addgene:122856 ; RRID:Addgene_122856)
  • For your References section:

    CRISPR-based tools for targeted transcriptional and epigenetic regulation in plants. Lee JE, Neumann M, Duro DI, Schmid M. PLoS One. 2019 Sep 26;14(9):e0222778. doi: 10.1371/journal.pone.0222778. eCollection 2019. 10.1371/journal.pone.0222778 PubMed 31557222