pKM50
(Plasmid #123656)

• Purpose: Encodes Renilla luciferase under the Aedes aegypti ubiquitin UbL40 promoter for constitutive expression in mosquito cells
• Depositing Lab: Kevin Maringer
• Publication: Fredericks et al PLoS Negl Trop Dis. 2019 Nov 6;13(11):e0007346. doi: 10.1371/journal.pntd.0007346. eCollection 2019 Nov.

Backbone

• Vector backbone: pRL-TK-Renilla
• Backbone manufacturer: Promega (Madison, WI USA)
• Backbone size w/o insert (bp): 3023
• Total vector size (bp): 3485
• Vector type: Insect Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Aedes aegypti UbL40 promoter
• Species: Aedes aegypti
• Insert Size (bp): 462
• Promoter: UbL40 promoter

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gaaacgcctggtatctttata
• 3′ sequencing primer: tgtcgccataaataagaagag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pSLfa-UbL40-EGFP (Raul Andino, University of California, San Francisco, CA USA) and pRL-TK-Renilla (Promega, Madison, WI USA)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The constitutive Renilla luciferase expression plasmid pKM50 was generated in-house by amplifying the Aedes aegypti ubiquitin UbL40 promoter from pSLfa-UbL40-EGFP (a kind gift from Raul Andino, University of California, San Francisco, CA USA) and cloned by In-Fusion (Takara Biosciences, Mountain View, CA USA) into pRL-TK-Renilla (Promega, Madison, WI USA) after the TK promoter was removed by digestion with BglII and BstBI.

Please visit https://www.biorxiv.org/content/10.1101/596205v1 for bioRxiv preprint.