pKM50
(Plasmid
#123656)
-
PurposeEncodes Renilla luciferase under the Aedes aegypti ubiquitin UbL40 promoter for constitutive expression in mosquito cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 123656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRL-TK-Renilla
-
Backbone manufacturerPromega (Madison, WI USA)
- Backbone size w/o insert (bp) 3023
- Total vector size (bp) 3485
-
Vector typeInsect Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAedes aegypti UbL40 promoter
-
SpeciesAedes aegypti
-
Insert Size (bp)462
- Promoter UbL40 promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gaaacgcctggtatctttata
- 3′ sequencing primer tgtcgccataaataagaagag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypSLfa-UbL40-EGFP (Raul Andino, University of California, San Francisco, CA USA) and pRL-TK-Renilla (Promega, Madison, WI USA)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The constitutive Renilla luciferase expression plasmid pKM50 was generated in-house by amplifying the Aedes aegypti ubiquitin UbL40 promoter from pSLfa-UbL40-EGFP (a kind gift from Raul Andino, University of California, San Francisco, CA USA) and cloned by In-Fusion (Takara Biosciences, Mountain View, CA USA) into pRL-TK-Renilla (Promega, Madison, WI USA) after the TK promoter was removed by digestion with BglII and BstBI.
Please visit https://www.biorxiv.org/content/10.1101/596205v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKM50 was a gift from Kevin Maringer (Addgene plasmid # 123656 ; http://n2t.net/addgene:123656 ; RRID:Addgene_123656) -
For your References section:
Aedes aegypti (Aag2)-derived clonal mosquito cell lines reveal the effects of pre-existing persistent infection with the insect-specific bunyavirus Phasi Charoen-like virus on arbovirus replication. Fredericks AC, Russell TA, Wallace LE, Davidson AD, Fernandez-Sesma A, Maringer K. PLoS Negl Trop Dis. 2019 Nov 6;13(11):e0007346. doi: 10.1371/journal.pntd.0007346. eCollection 2019 Nov. 10.1371/journal.pntd.0007346 PubMed 31693659