Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

NFATc3-CRISPR-gRNA#exon3-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
(Plasmid #124288)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 124288 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 62988)
  • Backbone size w/o insert (bp) 9200
  • Vector type
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    NFATc3 nuclear factor of activated T cells
  • Alt name
  • Alt name
  • gRNA/shRNA sequence
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    NFATC3 (a.k.a. NF-AT4c, NFAT4, NFATX)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer U6-fw: GGGCCTATTTCCCATGATTCCTTC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Plus "G" was routinely added because U6 promoter prefers "G" as the first transcribed nucleotide. gRNA sequence contains at least 3 mismatches, and was selected by choosing the highest scored sequence from different programs and databases.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NFATc3-CRISPR-gRNA#exon3-(pSpCas9(BB)-2A-Puro (PX459) V2.0) was a gift from Katalin Josvay & Csaba Vizler (Addgene plasmid # 124288 ; ; RRID:Addgene_124288)