Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #124641)


Item Catalog # Description Quantity Price (USD)
Plasmid 124641 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Karl Deisseroth (pAAV-Ef1a-DIO-hChR2(E123T/T159C)-mCherry, Addgene 35510)
  • Backbone size w/o insert (bp) 5603
  • Total vector size (bp) 6932
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
  • Promoter EF1a
  • Tag / Fusion Protein
    • myc tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CACCCACACAAAGGAAAAGGGCC
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-DIO-FLPo-Myc was a gift from David Dupret (Addgene plasmid # 124641 ; ; RRID:Addgene_124641)
  • For your References section:

    A Hippocampus-Accumbens Tripartite Neuronal Motif Guides Appetitive Memory in Space. Trouche S, Koren V, Doig NM, Ellender TJ, El-Gaby M, Lopes-Dos-Santos V, Reeve HM, Perestenko PV, Garas FN, Magill PJ, Sharott A, Dupret D. Cell. 2019 Mar 7;176(6):1393-1406.e16. doi: 10.1016/j.cell.2018.12.037. Epub 2019 Feb 14. 10.1016/j.cell.2018.12.037 PubMed 30773318