This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #62723)


Item Catalog # Description Quantity Price (USD)
Plasmid 62723 Plasmid sent as bacteria in agar stab 1 $65
AAV5 62723-AAV5 Virus (100 µL at titer ≥ 5×10¹² vg/mL)
and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    original from Stratagene
  • Backbone size w/o insert (bp) 4684
  • Total vector size (bp) 7180
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Chrimson K176R mutant- tdTomato
  • Alt name
  • Alt name
    Chlamydomonas noctigama channelrhodopsin K176R mutant-tdTomato
  • Species
    Chlamydomonas noctigama
  • Insert Size (bp)
  • Mutation
    Chrimson K176R mutant
  • GenBank ID
  • Promoter human synapsin promoter
  • Tag / Fusion Protein
    • tdTomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer gcacgggcgcgaccatctgc
  • 3′ sequencing primer TAGCGTAAAAGGAGCAACATAG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.

Information for AAV5 (Catalog # 62723-AAV5) ( Back to top )


Ready-to-use AAV5 particles produced from pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] (#62723). In addition to the viral particles, you will also receive purified pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] plasmid DNA.

Cre-dependent ChrimsonR-tdTomato under the control of the Synapsin promoter. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 5×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers that only produce amplicons in the original (non-flipped) orientation. PCR was also carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene and Orientation
    • Transgene and Orientation
  • Next-generation sequencing of viral genome: Next-generation sequencing was performed on viral genomes that were isolated from the final viral preparation. Sequencing results were analyzed to confirm the identity and integrity of the viral genome and the absence of unexpected DNA contaminants.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] was a gift from Edward Boyden (Addgene plasmid # 62723)
  • For your References section:

    Independent optical excitation of distinct neural populations. Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, Wang J, Xie Y, Yan Z, Zhang Y, Chow BY, Surek B, Melkonian M, Jayaraman V, Constantine-Paton M, Wong GK, Boyden ES. Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9. 10.1038/nmeth.2836 PubMed 24509633