1010C
(Plasmid
#125128)
-
PurposeExpresses FAR protein under 10xUAS control
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 125128 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepiggyback
- Backbone size w/o insert (bp) 6457
- Total vector size (bp) 9059
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFAR protein
-
Insert Size (bp)825
- Promoter 10xUAS
-
Tag
/ Fusion Protein
- 3xHA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gTCGACGATGTAGGTCACGGTCTC
- 3′ sequencing primer cctctaatagtcctctgtggcaagg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1010C was a gift from Omar Akbari (Addgene plasmid # 125128)