pTrcHIS-7D12Gln13TAG
(Plasmid
#125264)
-
PurposeExpresses 7D12 anti-EGFR nanobodies with UAG codon at Gln13 for synthetic amino acid in combination with pEVOL-pAzF
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125264 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTrcHis-TF2
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGln13TAG 7D12
-
Insert Size (bp)4699
-
Tag
/ Fusion Protein
- His-Tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gaggtatatattaatgtatcg
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTrcHIS-7D12Gln13TAG was a gift from Angus Johnston (Addgene plasmid # 125264 ; http://n2t.net/addgene:125264 ; RRID:Addgene_125264) -
For your References section:
Pointing in the Right Direction: Controlling the Orientation of Proteins on Nanoparticles Improves Targeting Efficiency. Yong KW, Yuen D, Chen MZ, Porter CJH, Johnston APR. Nano Lett. 2019 Mar 13;19(3):1827-1831. doi: 10.1021/acs.nanolett.8b04916. Epub 2019 Feb 21. 10.1021/acs.nanolett.8b04916 PubMed 30773887