-
Purposederivative of pFD116 with an optimized RBS for E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFD116 with an optimized RBS to use in E. coli
- Backbone size w/o insert (bp) 3729
- Total vector size (bp) 9131
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameoptimized RBS
-
Insert Size (bp)44
- Promoter anhydrotetracycline Ptet promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTTTTCCGTGATGGTAACTAACTAATAACGTAACGTGACTGGC
- 3′ sequencing primer GTTACGTTATTAGTTAGTTACCATCACGGAAAAAGGTTATGCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFD152 was a gift from David Bikard (Addgene plasmid # 125546 ; http://n2t.net/addgene:125546 ; RRID:Addgene_125546) -
For your References section:
Gene silencing with CRISPRi in bacteria and optimization of dCas9 expression levels. Depardieu F, Bikard D. Methods. 2019 Aug 1. pii: S1046-2023(18)30497-3. doi: 10.1016/j.ymeth.2019.07.024. 10.1016/j.ymeth.2019.07.024 PubMed 31377338