Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV-RdLight1
(Plasmid #125706)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 125706 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP_N1
  • Backbone size w/o insert (bp) 3983
  • Total vector size (bp) 6032
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RdLight1
  • Alt name
    red dopamine sensor
  • Species
    Synthetic
  • Insert Size (bp)
    2049
  • GenBank ID
    MK751450
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ggcgtgtacggtgggaggtc
  • 3′ sequencing primer gctgcaataaacaagttaacaacaac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-RdLight1 was a gift from Lin Tian (Addgene plasmid # 125706 ; http://n2t.net/addgene:125706 ; RRID:Addgene_125706)
  • For your References section:

    An expanded palette of dopamine sensors for multiplex imaging in vivo. Patriarchi T, Mohebi A, Sun J, Marley A, Liang R, Dong C, Puhger K, Mizuno GO, Davis CM, Wiltgen B, von Zastrow M, Berke JD, Tian L. Nat Methods. 2020 Nov;17(11):1147-1155. doi: 10.1038/s41592-020-0936-3. Epub 2020 Sep 7. 10.1038/s41592-020-0936-3 PubMed 32895537