-
PurposeExpresses an optimized mosquito OPN3 rhodopsin in-frame with mScarlet
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125712 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 3788
- Total vector size (bp) 5609
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeOPN3
-
Alt nameMosquito OPN3, optimized for mammalian neuron expression
-
gRNA/shRNA sequence-
-
SpeciesAnopheles stephensi (Asian malaria mosquito)
-
Mutationdeleted amino acids 331-429
-
GenBank IDAB753162.1
- Promoter short version of αCamKinase II promoter (0.4kb)
-
Tags
/ Fusion Proteins
- mScarlet (C terminal on insert)
- Rho1D4 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CKIIa_Fw (GATGCTGACGAAGGCTCGC)
- 3′ sequencing primer WPRE_Rev (CACACAGCGTAAAAGGAGCAAC) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.02.18.431673v1 for the bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE was a gift from Ofer Yizhar (Addgene plasmid # 125712 ; http://n2t.net/addgene:125712 ; RRID:Addgene_125712) -
For your References section:
Efficient optogenetic silencing of neurotransmitter release with a mosquito rhodopsin. Mahn M, Saraf-Sinik I, Patil P, Pulin M, Bitton E, Karalis N, Bruentgens F, Palgi S, Gat A, Dine J, Wietek J, Davidi I, Levy R, Litvin A, Zhou F, Sauter K, Soba P, Schmitz D, Luthi A, Rost BR, Wiegert JS, Yizhar O. Neuron. 2021 May 10. pii: S0896-6273(21)00161-6. doi: 10.1016/j.neuron.2021.03.013. 10.1016/j.neuron.2021.03.013 PubMed 33979634