Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Lenti-CamKII-PSD95.FingR-eGFP-CCR5TC
(Plasmid #126218)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 126218 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHR
  • Backbone size w/o insert (bp) 9247
  • Total vector size (bp) 10854
  • Modifications to backbone
    Inserted CCR5TC DNA binding sequence upstream of promoter.
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PSD95.FingR-eGFP-CCR5TC
  • Insert Size (bp)
    1596
  • Promoter CamKIIa

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTGTGAGCAGCCACAGTGC
  • 3′ sequencing primer CCAGTCAATCTTTCACAAAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Part of this gene was derived from Addgene plasmid 46295 deposited by Don Arnold.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-CamKII-PSD95.FingR-eGFP-CCR5TC was a gift from Xue Han (Addgene plasmid # 126218 ; http://n2t.net/addgene:126218 ; RRID:Addgene_126218)
  • For your References section:

    A Viral Toolbox of Genetically Encoded Fluorescent Synaptic Tags. Bensussen S, Shankar S, Ching KH, Zemel D, Ta TL, Mount RA, Shroff SN, Gritton HJ, Fabris P, Vanbenschoten H, Beck C, Man HY, Han X. iScience. 2020 Jun 30;23(7):101330. doi: 10.1016/j.isci.2020.101330. 10.1016/j.isci.2020.101330 PubMed 32674057