MSCV-Syn-PSD95.FingR-eGFP
(Plasmid
#126212)
-
PurposeLabeling of excitatory synapses (green fluorescence) in dividing cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126212 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMCSV
- Backbone size w/o insert (bp) 6181
- Total vector size (bp) 7231
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePSD95.FingR-eGFP
-
Insert Size (bp)1032
- Promoter Synapsin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGCGGTGGGCAGCGG
- 3′ sequencing primer CCAGTCAATCTTTCACAAAT (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byPart of this gene was derived from Addgene plasmid 46295 deposited by Don Arnold.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A duplication of the EGFP is present in the sequence, but the plasmid functions as described in the publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-Syn-PSD95.FingR-eGFP was a gift from Xue Han (Addgene plasmid # 126212 ; http://n2t.net/addgene:126212 ; RRID:Addgene_126212) -
For your References section:
A Viral Toolbox of Genetically Encoded Fluorescent Synaptic Tags. Bensussen S, Shankar S, Ching KH, Zemel D, Ta TL, Mount RA, Shroff SN, Gritton HJ, Fabris P, Vanbenschoten H, Beck C, Man HY, Han X. iScience. 2020 Jun 30;23(7):101330. doi: 10.1016/j.isci.2020.101330. 10.1016/j.isci.2020.101330 PubMed 32674057