pR26-CMVconst
(Plasmid #127373)

• Purpose: (Empty Backbone) Allows for constitutive gene expression from the murine ROSA26 safe harbor locus upon CRISPR/Cas9-mediated genomic insertion and stable selection.
• Depositing Lab: Lance Miller
• Publication: Routh et al Front Immunol. 2020 Feb 13;11:57. doi: 10.3389/fimmu.2020.00057. eCollection 2020.

Backbone

• Vector backbone: pCR-Blunt II-TOPO
• Backbone manufacturer: Invitrogen (Life Technologies)
• Backbone size (bp): 7941
• Modifications to backbone: Inserted left and right ROSA26 homology arms, adenoviral splice acceptor, MCS, and DNA sequence encoding machinery facilitating constitutive gene expression (CMV enhancer/promoter), as well as PuroR resistance gene for stable selection.
• Vector type: Mouse Targeting, CRISPR
• Promoter: CMV enhancer/promoter
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
  • Addgene Diagnostic Digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note, there is not a Kozak sequence associated with the MCS. Therefore, it is necessary to include the Kozak sequence (CGGTGG) in the forward primer used to amplify your gene of interest prior to cloning into the plasmid.