pSB1C3_YPet-PCP (y-plasmid)
(Plasmid #127637)

• Purpose: Encodes a fluorecent protein with an RNA binding peptide: YPet-PCP.Expression with constitutive E. coli RNAP promoter (J23106), ribozyme RiboJ and RBS BBa_B0034.
• Depositing Lab: Friedrich Simmel
• Publication: Schwarz-Schilling et al Nano Lett. 2018 Apr 11;18(4):2650-2657. doi: 10.1021/acs.nanolett.8b00526. Epub 2018 Mar 27.

Backbone

• Vector backbone: pSB1C3
• Backbone size w/o insert (bp): 2100
• Total vector size (bp): 3488
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: YPet
• Alt name: YFP
• Alt name: fluorescent recombinant protein
• Species: Synthetic
• Insert Size (bp): 1220
• Promoter: pJ21306
• Tag / Fusion Protein:
  • RNA binding peptide: PP7 coat protein (PCP) (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SpeI (unknown if destroyed)
• 5′ sequencing primer: TGCCACCTGACGTCTAAGAA
• 3′ sequencing primer: ATTACCGCCTTTGAGTGAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The insert YPet-PCP was designed by G.Grossi and M. Schwarz-Schilling and cloned by A. Dupin and M. Schwarz-Schilling. YPet sequence is from Nguyen, A. W. and Daugherty, P. S. Nat. Biotechnol. 2005, 23, 355−360. PCP sequence is from Chao, J. A. et al. Nat. Struct. Mol. Biol. 2008, 15, 103−105. The peptide linker sequence between between YPet and PCP is TRGGGGS.