pSB1C3_YPet-PCP (y-plasmid)
(Plasmid
#127637)
-
PurposeEncodes a fluorecent protein with an RNA binding peptide: YPet-PCP.Expression with constitutive E. coli RNAP promoter (J23106), ribozyme RiboJ and RBS BBa_B0034.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127637 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSB1C3
- Backbone size w/o insert (bp) 2100
- Total vector size (bp) 3488
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYPet
-
Alt nameYFP
-
Alt namefluorescent recombinant protein
-
SpeciesSynthetic
-
Insert Size (bp)1220
- Promoter pJ21306
-
Tag
/ Fusion Protein
- RNA binding peptide: PP7 coat protein (PCP) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SpeI (unknown if destroyed)
- 5′ sequencing primer TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer ATTACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insert YPet-PCP was designed by G.Grossi and M. Schwarz-Schilling and cloned by A. Dupin and M. Schwarz-Schilling. YPet sequence is from Nguyen, A. W. and Daugherty, P. S. Nat. Biotechnol. 2005, 23, 355−360. PCP sequence is from Chao, J. A. et al. Nat. Struct. Mol. Biol. 2008, 15, 103−105. The peptide linker sequence between between YPet and PCP is TRGGGGS.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB1C3_YPet-PCP (y-plasmid) was a gift from Friedrich Simmel (Addgene plasmid # 127637 ; http://n2t.net/addgene:127637 ; RRID:Addgene_127637) -
For your References section:
Optimized Assembly of a Multifunctional RNA-Protein Nanostructure in a Cell-Free Gene Expression System. Schwarz-Schilling M, Dupin A, Chizzolini F, Krishnan S, Mansy SS, Simmel FC. Nano Lett. 2018 Apr 11;18(4):2650-2657. doi: 10.1021/acs.nanolett.8b00526. Epub 2018 Mar 27. 10.1021/acs.nanolett.8b00526 PubMed 29564885