pAC575
(Plasmid
#127976)
-
PurposeAMA1 plasmid with ble selection marker, and USER cassette (PacI/Nt.BbvCI)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127976 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonecustom
- Total vector size (bp) 10152
-
Modifications to backboneAMA1 element
-
Vector typeBacterial Expression ; Fungal Expression
-
Selectable markersZeocin ; Bleomycin ; Phleomycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameble (bleomycin resistance marker)
-
SpeciesStreptoalloteichus hindustanus
-
Insert Size (bp)375
- Promoter Aspergillus nidulans trpC promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GATCTCATGGTCATAGCTGTTTCC
- 3′ sequencing primer GTGTCGCCCTTATTCGACTCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
AMA1 sequence contains multiple ambiguous bases that are likely mixed nucleotide populations. AMA1 is a palindrome and thus difficult to sequence. Dep. confirms the mixed population does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC575 was a gift from Uffe Mortensen (Addgene plasmid # 127976 ; http://n2t.net/addgene:127976 ; RRID:Addgene_127976) -
For your References section:
Cpf1 enables fast and efficient genome editing in Aspergilli. Vanegas KG, Jarczynska ZD, Strucko T, Mortensen UH. Fungal Biol Biotechnol. 2019 May 1;6:6. doi: 10.1186/s40694-019-0069-6. eCollection 2019. 10.1186/s40694-019-0069-6 PubMed 31061713