Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pU6-sgRNA EF1Alpha-puro-T2A-BFP.PAPD4-1
(Plasmid #128756)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 128756 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSICO derivative
  • Total vector size (bp) 8877
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PAPD4 sgRNA #1
  • gRNA/shRNA sequence
    GCGTGACCCCGGATGAGAAT
  • Species
    H. sapiens (human)
  • Entrez Gene
    TENT2 (a.k.a. APD4, GLD2, PAPD4, TUT2)
  • Promoter mU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstXI (not destroyed)
  • 3′ cloning site BlpI (not destroyed)
  • 5′ sequencing primer mU6-F
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-sgRNA EF1Alpha-puro-T2A-BFP.PAPD4-1 was a gift from David Bartel (Addgene plasmid # 128756 ; http://n2t.net/addgene:128756 ; RRID:Addgene_128756)
  • For your References section:

    A Network of Noncoding Regulatory RNAs Acts in the Mammalian Brain. Kleaveland B, Shi CY, Stefano J, Bartel DP. Cell. 2018 Jul 12;174(2):350-362.e17. doi: 10.1016/j.cell.2018.05.022. Epub 2018 Jun 7. 10.1016/j.cell.2018.05.022 PubMed 29887379