1
Plasmid 13014: pcDNA3-TLR1-YFP
  • Toll-Like Receptor 1

  • TLR1

  • CD281

  • TIL

  • 2358

  • H. sapiens (human)

  • BC109093

  • TLR1 (CD281, TIL, TIL. LPRS5, rsc786)

  • YFP

  • C terminal on backbone

  • pcDNA3-YFP
    (Search Vector Database)

  • Mammalian Expression

  • 6100

  • BamHI / BglII

  • Yes

  • XhoI

  • No

  • T7 List of Sequencing Primers

  • GTCTTGTAGTTGCCGTCGTC

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Neomycin

  • View sequences (3)
  • Doug Golenbock

  • MTA

Comments: 

The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 13014" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only